.

Description of your first forum.

Postby dadman » Sat Oct 12, 2013 3:16 pm

Image Image
Image Image Image Image Image Image Image Image Image Image .. The evidence is ID
Image

Image Image Image Image Image Image Image Image Image Image Image
Image
Image Image Image Image Image Image Image Image Image Image

the cells design .. reasons to believe .. Genomics 101 .. Dr Hugh Ross .. oops !! and then there was man .. Darwins Dilemma .. Metamorphosis
Unlocking the Mystery of Life .. The Case for a Creator .. Where Does the Evidence Lead .. Intelligent Design vs Evolution ..



15 questions

Image medias and headlines 2019

01-29-2022 .. Stephen Meyere
01-28-2022 .. What's wrong w/ atheism - Stephen Meyere

12-07-2019 .. Why DNA Is The SOFTWARE CODE To The MATRIX And All Life
11-14-2019 .. Center for Science & Culture - FB
07-16-2019 .. How the Origin of Life Points to the Existence of God
07-11-2019 .. Information can only be generated by a mind - RF
07-11-2019 .. Origin: Probability of a Single Protein Forming by Chance
07-01-2019 .. Stephen Meyer: DNA and Information
07-01-2019 .. Origin of Life: Intelligence Required (Science Uprising 05)
06-18-2019 .. DNA Is Code: Who Coded It?
04-25-2019 .. Something from Nothing ?? - RF
04-24-2019 .. Creation - the eyewitness account of - John MacArthur
04-23-2019 .. DEBATE RF
04-23-2019 .. DNA is a language / information storage system - google
04-23-2019 .. Inside the Cell: DNA as a Library
03-19-2019 .. Physicist Marcelo Gleiser: 'Science does not kill God'
03-03-2018 .. Create Debate
02-26-2018 .. Dr. Michio Kaku dishes on spirituality, Einstein, and God in this latest installment of Dr. Kiki's
01-24-2018 .. Answers Radio

Image Debates =================================

Unbeliever 04-23-2019 .. RF / Bob the Unbeliever
Darkstorn 04-23-2019 .. RF / Darkstorn

Image medias and headlines 2018

12-12-2018 .. In Cambrian Explosion Debate, ID Wins by Default
11-07-2018 .. Why Evolution and Reproduction Are Unnatural
03-19-2018 .. God's problem Is a Lack of Evidence
03-11-2018 .. $5 Million Tech Prize Seeks Answer to Origin of Life
01-27-2018 .. top 30 evidences for God

Image medias and headlines 2017

12-01-2017 .. Evidence for Creation / podcast (scroll to bottom)
11-22-2017 .. Science And The Bible
11-20-2017 .. Complex grammar in the genome defies evolution
11-20-2017 .. Complex grammar of the genomic language
11-19-2017 .. Dr Stephen Meyer post at forum
11-11-2017 .. DNA Molecules and the Odds Against Evolution
10-13-2017 .. Replacing Darwin: The New Origin of Species with Dr. Nathaniel Jeanson / FB
07-10-2017 .. Perry Marshall FB
06-30-2017 .. DEBATE the FES
05-03-2017 .. DNA-Cactus-and_Von_Neumann_Machines.mp3
02-15-2017 .. Dr Stephen Myere ... youtube

Image Image Image

Image headlines 2016

11-26-2016 .. Ocean of water discovered 620 miles below Earth’s surface


Image

Creation / the theology of

https://www.facebook.com/isgenesishistory/

https://www.facebook.com/prageru/videos ... f=NEWSFEED

the known Universe https://www.facebook.com/JamieJanover.a ... 117963907/

Image

Science Has Found Evidence Of God; Scientists Confused. Watch And Be Amazed! http://www.imsoblesseddaily.com/science ... -confused/

proof there is a God .... https://www.facebook.com/ILEARNEDALOTDO ... f=NEWSFEED

Michio Kaku: Is God a Mathematician? .... http://www.createdebate.com/debate/show ... God_Exists .... https://www.youtube.com/watch?v=jremlZvNDuk
Werner Heisenburg ( Father of Quantum Physics ) https://www.facebook.com/neil.matthews. ... 2532730772

Microbiologist Loses Faith In Evolution https://www.youtube.com/watch?v=46OzGYq ... e=youtu.be
a must watch https://www.youtube.com/watch?v=JiMqzN_YSXU
http://www.amazon.com/Miracles-What-The ... 0525954422
10-things-i-wish-everyone-knew-about-creation-vs-evolution
GC Science
Darwins Doubt - Dr Stephen Meyer
Does the Universe Have an Explanation.mp3
Reasonable Faith Podcast
Question Evolution
Creation TV
Patterns and Codes
DNA Sequence A or B
DNA: the tiny code thats toppling evolution
Dr Hugh Ross
the complexity of God's creation ... God's fine tuning Universe
intelligentdesign.podomatic.com
The Workhorse of the Cell: Kinesin
nothing more than a bag of chemicals
God of wonders
the Big Bang
the ham / Nye debate
Socrates in the city
Abiogenesis and information
bag of chemical reactions .. just a
Discovering Intelligent Design
The Return of the God Hypothesis
Answers to Atheists Objections
Neanderthal man DNA
Darwin's god
the audio pool . . . listen .. Creation Station
Intelligent design / debate
Information from an intelligent source

http://rzim.org/global-blog/john-lennox ... us-science .... https://www.youtube.com/watch?v=PSq4KLjMSlI

Evolution is a Natural Process Running Backward http://youtu.be/259r-iDckjQ

http://www.evolutionnews.org/2013/08/wh ... 75281.html

Duelling Professors (Peter Atkins vs John Lennox) http://www.youtube.com/watch?v=Yx0CXmagQu0

http://creation.com/

http://www.intelligentdesign.org/index.php

http://www.oldearth.org/evolution_bible.htm

matter / energy and information https://www.google.com/search?q=matter+ ... =firefox-a

Infinite multiverse and God; Acceleration of cosmic expansion; Homogeneous and isotropic universe; Anti-matter decay
http://nwcreation.net/intelligentdesign.html
http://creation.com/







DNA contains a genetic language http://defendingthetruth.com/atheism/21 ... post844695



























































http://evoillusion.org/the-dna-code-and-its-codons/

the atheists Universe (a happy coincidence) ................
For Every Cause (Because) There is an Effect ... Therefore, the Universe Exists as an Effect .... What is its Cause ?

100100101101011011010101 same as tagcacgtacgtcgactcgtacgtgactgtagctc .....

LIFE .. what is it made up of .... matter alone ? .... or is there an non-material element needed inorder for life to exist ? .... what would that element be ?

I have not yet found an atheist willing to debate the scientific fact that all life is derived from an intelligent source

which is more complex ... binary code (10010010110101101001001010101) .... or

Genetic code in DNA (aggcgtcagtcataacagtcgtcagtcatcacagtcgtcagtgataac)
each of the 50 to 150 trillian cells in an average human body containing a stran of DNA up to 4 billion characters long

CODE IS DEFINED .. as communication between an encoder .. XXXXX .. refute this if you like .. or to make this simple .. just say yes .. I agree
how bout a simple true or false question for xxxxx .. Is DNA considered to be code ...... yes or no
I have yet to discover an atheist willing to debate the scientific fact that all life derives from an intelligent source

what else falls into the parameter of code / information .. a writer and a reader of specifically recognized and agreed symbols .... music / blue prints / alphabet .. name some more xxxxx

display a code (any code) that is not the result of an intelligent source


(BIG BANG !!!!!) time / force / action / space and matter .... In the beginning (time) God (fource) created (action) the Heavens (space) and the Earth (matter) ....
http://www.gty.org/MediaPlayer/sermons/90-208 - part 1
http://www.gty.org/MediaPlayer/sermons/90-209 - part 2
Full series http://www.gty.org/products/Audio-Serie ... -Beginning

Out of all man's intelligence / ingenuity / inventionism from ages past to ages present and future ... has man EVER been able to invent a machine so complex that that machine has the ability to repair and duplicate itself .... YET . EVERY living cell on our planet has that ability ..... to WHOM do you attribute this intelligence to ?? ....











<a href="http://dadmansabode.com/forum/viewtopic.php?p=8#p8"><IMG SRC="http://dadmansabode.com/header07g.jpg"></a>




Ocean of water discovered 620 miles below Earth’s surface
00-00-2019 .. DESCRIPTION
Image
dadman
Site Admin
 
Posts: 3858
Joined: Sat Oct 12, 2013 11:05 am

PreviousNext

Return to Your first forum

Who is online

Users browsing this forum: No registered users and 2 guests