12-07-2019 .. Why DNA Is The SOFTWARE CODE To The MATRIX And All Life 11-14-2019 .. Center for Science & Culture - FB 07-16-2019 .. How the Origin of Life Points to the Existence of God 07-11-2019 .. Information can only be generated by a mind - RF 07-11-2019 .. Origin: Probability of a Single Protein Forming by Chance 07-01-2019 .. Stephen Meyer: DNA and Information 07-01-2019 .. Origin of Life: Intelligence Required (Science Uprising 05) 06-18-2019 .. DNA Is Code: Who Coded It? 04-25-2019 .. Something from Nothing ?? - RF 04-24-2019 .. Creation - the eyewitness account of - John MacArthur 04-23-2019 .. DEBATE RF 04-23-2019 .. DNA is a language / information storage system - google 04-23-2019 .. Inside the Cell: DNA as a Library 03-19-2019 .. Physicist Marcelo Gleiser: 'Science does not kill God' 03-03-2018 .. Create Debate 02-26-2018 .. Dr. Michio Kaku dishes on spirituality, Einstein, and God in this latest installment of Dr. Kiki's 01-24-2018 .. Answers Radio
12-12-2018 .. In Cambrian Explosion Debate, ID Wins by Default 11-07-2018 .. Why Evolution and Reproduction Are Unnatural 03-19-2018 .. God's problem Is a Lack of Evidence 03-11-2018 .. $5 Million Tech Prize Seeks Answer to Origin of Life 01-27-2018 .. top 30 evidences for God
medias and headlines 2017
12-01-2017 .. Evidence for Creation / podcast (scroll to bottom) 11-22-2017 .. Science And The Bible 11-20-2017 .. Complex grammar in the genome defies evolution 11-20-2017 .. Complex grammar of the genomic language 11-19-2017 .. Dr Stephen Meyer post at forum 11-11-2017 .. DNA Molecules and the Odds Against Evolution 10-13-2017 .. Replacing Darwin: The New Origin of Species with Dr. Nathaniel Jeanson / FB 07-10-2017 .. Perry Marshall FB 06-30-2017 .. DEBATE the FES 05-03-2017 .. DNA-Cactus-and_Von_Neumann_Machines.mp3 02-15-2017 .. Dr Stephen Myere ... youtube
headlines 2016
11-26-2016 .. Ocean of water discovered 620 miles below Earth’s surface
the atheists Universe (a happy coincidence) ................ For Every Cause (Because) There is an Effect ... Therefore, the Universe Exists as an Effect .... What is its Cause ?
100100101101011011010101 same as tagcacgtacgtcgactcgtacgtgactgtagctc .....
LIFE .. what is it made up of .... matter alone ? .... or is there an non-material element needed inorder for life to exist ? .... what would that element be ?
I have not yet found an atheist willing to debate the scientific fact that all life is derived from an intelligent source
which is more complex ... binary code (10010010110101101001001010101) .... or
Genetic code in DNA (aggcgtcagtcataacagtcgtcagtcatcacagtcgtcagtgataac) each of the 50 to 150 trillian cells in an average human body containing a stran of DNA up to 4 billion characters long
CODE IS DEFINED .. as communication between an encoder .. XXXXX .. refute this if you like .. or to make this simple .. just say yes .. I agree how bout a simple true or false question for xxxxx .. Is DNA considered to be code ...... yes or no I have yet to discover an atheist willing to debate the scientific fact that all life derives from an intelligent source
what else falls into the parameter of code / information .. a writer and a reader of specifically recognized and agreed symbols .... music / blue prints / alphabet .. name some more xxxxx
display a code (any code) that is not the result of an intelligent source
Out of all man's intelligence / ingenuity / inventionism from ages past to ages present and future ... has man EVER been able to invent a machine so complex that that machine has the ability to repair and duplicate itself .... YET . EVERY living cell on our planet has that ability ..... to WHOM do you attribute this intelligence to ?? ....